nfrA [2018-07-31 13:03:44]

Spx-dependent FMN-containing NADPH-linked nitro/flavin reductase, stress protein

Locus: BSU38110

Isoelectric point: 5.73

Molecular weight: 28.17 kDa

Protein length: 249 aa

Gene length: 747 bp

Function: unknown

Product: FMN-containing NADPH-linked nitro/flavin reductase

Essential: no

Synonyms: ywcG, ipa-43d

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Electron transport and ATP synthesis → Electron transport/ other
• Lifestyles → Coping with stress → Resistance against oxidative and electrophile stress

Gene

Coordinates: 3,911,477 → 3,912,226

The protein

Catalyzed reaction/ biological activity

• possesses an NADH oxidase activity that leads to high concentrations of oxygen peroxide and an NAD( ) degrading activity leading to free nicotinamide PubMed

Protein family

• flavin oxidoreductase frp family (according to Swiss-Prot)

Cofactors

• FMN or FAD PubMed

Structure

• 3N2S PubMed

Expression and Regulation

Operons

• Genes: nfrA-ywcH
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigD: sigma factor, PubMed, in SigD regulon

  Regulatory mechanism

  • Spo0A: repression, PubMed, in Spo0A regulon
  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed
  • induced by cell wall stress (Spx) PubMed

Biological materials

Mutant

• MGNA-B232 (ywcG::erm), available at the NBRP B. subtilis, Japan
• BKE38110 (ΔnfrA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCACAAAAACCTCCTTAT, downstream forward: _UP4_TAAAGCAAACCTCTCCGTCT
• BKK38110 (ΔnfrA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCACAAAAACCTCCTTAT, downstream forward: _UP4_TAAAGCAAACCTCTCCGTCT

References

Loading